Introduction
Thiamine-responsive megaloblastic anaemia syndrome (TRMA) is a rare genetic disorder caused by mutations in the SLC19A2 gene, the gene encoding thiamine transporter 1 (THTR-1) containing 497 amino acids [1]. Its common clinical manifestations are diabetes mellitus, anaemia, and deafness [2]. THTR-1 is expressed in various human tissues such as bone marrow, pancreas, brain, retina, heart, skeletal muscle, kidney, liver, lung, small intestine, colon, and placenta, which is mainly responsible for transporting thiamine absorbed by intestinal epithelial cells into the tissue cells to maintain normal cellular metabolism [3, 4]. Impaired THTR-1 transport causes intracellular thiamine deficiency, which affects normal cellular metabolism and leads to a variety of diseases, such as diabetes mellitus [5]. The occurrence and development of diabetes mellitus is closely related to the occurrence of endoplasmic reticulum stress (ERS) in pancreatic β-cells [6, 7]. Pancreatic islet β-cells have abundant endoplasmic reticulum (ER), which is an important organelle in eukaryotic cells and an important site for intracellular glucose and lipid metabolism [8], as well as a major site for intracellular glycosylation modification, protein modification and proper protein folding [9]. ER dysfunction occurs when unfolded or misfolded proteins accumulate and calcium homeostasis in cells is disrupted, thereby causing ERS. Sustained ERS response, an unfolded protein response, triggers pancreatic β-cell apoptosis, leading to insufficient insulin secretion and diabetes mellitus [10, 11]. There are 3 ERS signalling pathways, including protein kinases R-like endoplasmic reticulum kinase (PERK), inositol-requiring enzyme 1 (IRE1), and activating transcription factor 6 (ATF6) pathways [12].
4-henylbutyric acid (4-PBA) is a non-selective, low molecular weight fatty acid that has been approved by the U.S. Food and Drug Administration as an ammonia scavenger for the treatment of chronic urea cycle disorders [13]. Meanwhile, 4-PBA acts as a chemical chaperone of ER and may play a protective role by assisting in the recovery of unfolded or misfolded proteins, thereby mitigating ERS-induced damage to the organism [14, 15]. Several studies have shown that 4-PBA has a protective effect against ERS-induced apoptosis in pancreatic β-cells and delays the occurrence and development of diabetes mellitus [16, 17].
We previously identified the TRMA family. The proband’s novel pathogenic mutation in SLC19A2 (c.1409insT) resulted in a frameshift mutation at amino acid 27 of the THTR-1 protein’s C-terminus, causing premature termination of protein translation. This resulted in an incomplete THTR-1 peptide chain, leading to protein dysfunction. The proband exhibited symptoms of diabetes and anaemia, accompanied by elevated gene expression levels of ERS-related factors, including glucose-regulated protein 78 (GRP78), C/EBP homologous protein (CHOP), and activated transcription factor 4 (ATF4) in the blood [18]. ERS is closely related to the occurrence and development of diabetes mellitus, but the pathogenic mechanism by which THTR-1 deficiency triggers diabetes mellitus through ERS-mediated apoptosis of pancreatic β-cells has not been reported [19]. In this study, we constructed a rat pancreatic cancer cell line INS.1 SLC19A2 (c.1409insT) mutation model and pretreated the cells with ERS inhibitor 4-PBA. Our objective is to investigate the pathogenesis of diabetes in TRMA patients triggered by abnormal THTR-1 function through the ERS, and to elucidate how 4-PBA protects islet β cells by inhibiting ERS. This should provide novel insights and intervention targets for the prevention and treatment of TRMA and diabetes. Although this is a preclinical study based on cellular model, it provides crucial information and indicates the future direction of the prevention and treatment of TRMA and diabetes mellitus.
Material and methods
Cell culture
Rat insulinoma INS.1 cells were purchased from Procell, Wuhan, China. INS.1 cells were cultured with 89% RPMI-1640 medium (Gibco, Waltham, MA, USA) containing 10% foetal bovine serum (FBS, Gibco, Waltham, MA, USA) and 1% penicillin and streptomycin solution (Hyclone, Logan, Utah, USA) in a 37°C constant temperature incubator containing 5% CO2 (Thermo Scientific, Waltham, MA, USA).
Cell modelling
pLVX-IRES-Hyg-HA-SLC19A2 and pLVX-IRES-Hyg-HA-mutSLC19A2-c.1409insT plasmids were constructed with the assistance of Guangzhou IGE Biotechnology Ltd. The empty plasmids used in the control group, pLenti-EF1a-EGFP-T2A-Hyg-CMV-MCS-WPRE, were provided by OBiO, Shanghai, China. Using a lentiviral packaging system, HEK293T cells were transfected to obtain the virus encapsulating the 2 overexpression plasmids and the control virus. INS.1 cells were transfected with the control virus and overexpression virus. After 48 hours, the cell culture medium was changed, and hygromycin was added to screen for positive cell clones. Stable overexpression cell lines were then harvested. Consistent with the modelling methods in our previous work [20].
Cell viability assay using the cell counting kit-8 method
INS.1 cells with empty plasmid, overexpressed wild-type SLC19A2, and mutant SLC19A2 (c.1409insT) at the exponential growth stage were inoculated into three 96-well plates at a density of 7 × 103 cells per well, respectively. The cell incubation time in each plate was 24, 48, and 72 hours. Cell counting kit 8 (CCK-8) solution (10 μL; Dojindo, Shanghai, China) was added, and the 96-well plates were incubated in a 37°C incubator for 2 hours. The absorbance at 450 nm in each group was then measured using a microplate reader (Thermo Scientific, Waltham, MA, US).
4-PBA (Shanghai Yuanye Bio-Technology Co., Ltd., Shanghai, China), an ERS inhibitor, was used to treat the cells. Pretreated cells were inoculated into 96-well plates at a density of 17 × 103 cells per well. Cell viability was determined by the CCK-8 assay after 24 hours of incubation with 0, 2.5, 5.0, 10, 25, and 50 mM 4-PBA.
Flow cytometry
The Annexin V-AF647/7-AAD apoptosis kit (Elabscience, Wuhan, China) was used to identify apoptotic cells as measured by flow cytometry (Beckman Coulter, USA).
Quantitative real-time fluorescence polymerase chain reaction (qRT-PCR)
Total RNA was extracted using NucleoZol reagent (MNG, Germany), and cDNA was produced via reverse transcription using the Prime Script™ RT Master Mix kit (Takara, Dalian, China). Quantitative real-time fluorescence PCR (qRT-PCR) was performed using the TB Green Premix Ex Taq II kit (Takara, Dalian, China), and cell expansion was performed using 7500 Fast or Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The mRNA expression level of target genes was normalised to GAPDH as an endogenous control and calculated using the 2-ΔΔCT method. Primer sequences are shown in Table 1.
|
Genes |
Forward primer sequence (5’-3’) |
Reverse primer sequence (5’-3’) |
|
GAPDH |
GGCACAGTCAAGGCTGAGAATG |
ATGGTGGTGAAGACGCCAGTA |
|
SLC19A2 |
TGGGACCAGGGCTTCACAA |
AACGATTTCCATCTGCGGACA |
|
PERK |
CCAAGCTGTACATGAGCCCAGA |
TTTCTGAGTGAACAGTGGTGGAAAC |
|
eIF2α |
GGTTACGAAGGCATTGATGCTG |
TGTCATCACATACCTGGGTGGAG |
|
ATF4 |
AGTCTGCCTTCTCCAGGTGTTC |
GCTGTCTTGTTTTGCTCCATCTT |
|
GRP78 |
TCAGCCCACCGTAACAATCAAG |
TCCAGTCAGATCAAATGTACCCAGA |
|
CHOP |
TGGAAGCCTGGTATGAGGATCTG |
GAGGTGCTTGTGACCTCTGCTG |
|
Bcl-2 |
GACTGAGTACCTGAACCGGCATC |
CTGAGCAGCGTCTTCAGAGACA |
Western blot assay
Cells were lysed with radioimmunoprecipitation assay (RIPA) lysis buffer and phosphoprotease inhibitor for 30 minutes, and the cell lysate was centrifuged at 12,000 rpm for 15 minutes at 4°C. The supernatant was obtained and used for protein concentration determination using the BCA Protein Assay Kit (Beyotime, Shanghai, China). Proteins were separated on a 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis and electrotransferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, MA, USA). The membranes were mounted with 5% skimmed milk for one hour, washed with Tris-buffered saline with 0.1% Tween® 20 detergent (TBST) buffer, and incubated overnight at 4°C with the following primary antibodies: SLC19A2 (1:500–1:2000, Bioss, Beijing, China), β-actin (1:1000, CST, Boston, USA), PERK (1:1000, CST. Boston, USA), eukaryotic initiation factor 2α (eIF2α) (1:1000, CST, Boston, USA), phosphorylated eIF2α (P-eIF2α) (1:1000-1:8000, Proteintech, Chicago, USA), ATF4 (1:1000, CST, Boston, USA), BiP (1:1000, CST Boston, USA), and CHOP (1:1000, CST, Boston, USA). On the next day, the PVDF membranes were rinsed in TBST buffer and then incubated with a goat anti-rabbit fluorescent secondary antibody (1:30,000, CST, Boston, USA) for one hour. Protein bands were visualised on an infrared fluorescence scanning imaging system (Bio-Rad, USA), and analysed using ImageJ software (National Institutes of Health, Inc. USA).
Statistical analysis
Each experiment in this study was repeated at least 3 times, and experimental data were expressed as mean ± standard deviation. Statistical analyses were performed using SPSS 20.0 (SPSS, Chicago, USA). The Shapiro-Wilk test was used to evaluate the normality of the data in this study. The independent samples t-test was used for comparisons between 2 groups and one-way analysis of variance for comparisons among multiple groups. A value of p < 0.05 was considered statistically significant.
Results
SLC19A2 (c.1409insT) mutation triggers ERS in INS.1 cells
SLC19A2 (c.1409insT) mutation triggered ERS in INS.1 cells as follows: compared with the empty plasmid and wild-type SLC19A2 groups, there was an increase in the expression of ERS-associated molecules PERK, ATF4, GRP78, and CHOP at both mRNA and protein levels (Fig. 1).
The SLC19A2 (c.1409insT) mutation promotes apoptosis and decreases cell proliferation in INS.1 cells
Flow cytometry results showed that the apoptotic rate was significantly higher in the SLC19A2 (c.1409insT) mutant group than the empty plasmid and wild-type SLC19A2 groups (Fig. 2AB), indicating that the SLC19A2 (c.1409insT) mutation promotes apoptosis in INS.1 cells. Cell counting kit-8 assay results showed that the absorbance values of INS.1 cells with SLC19A2 (c.1409insT) mutation were significantly lower than those of the empty plasmid group and the wild-type SLC19A2 group at 24, 48, and 72 hours (p < 0.01; p < 0.05), while there was no significant difference in the absorbance values between the empty plasmid group and wild-type SLC19A2 group at each observation time point (Fig. 2C). Thus, the SLC19A2 (c.1409insT) mutation could inhibit the proliferation of INS.1 cells.
Survival of INS.1 cells after treatment with 4-PBA
To evaluate the effect of 4-PBA on INS.1 cells, 4-PBA at concentrations of 2.5, 5.0, 10, 25, and 50 mM was added to treat INS.1 cells for 24 hours, and cell viability was determined using the CCK8 assay (Fig. 4). The detection results showed that 2.5 mM 4-PBA had no effect on cell viability when applied to INS.1 cells for 24 hours (Fig. 3).
4-PBA inhibits SLC19A2 (c.1409insT) mutation-induced ERS in INS.1 cells
4-PBA, as a chemical chaperone of the ER, can reduce the load of unfolded proteins in the ER by increasing the folding capacity and transporting mutant proteins out of the ER. After 12 and 24 hours of treatment with 4-PBA, the mRNA and protein levels of GRP78, CHOP, and phosphorylated eukaryotic initiation factor 2α (eIF2α) in INS.1 cells were significantly downregulated in the SLC19A2 (c.1409insT) mutant group (Fig. 4).
Discussion
TRMA is a rare monogenic autosomal recessive disorder, characterised by the occurrence of anaemia, diabetes mellitus, and deafness, which are the TRMA triad [21, 22]. Zhang et al. [23] conducted an epidemiological survey and found that 140 (92.7%) of 151 patients genetically diagnosed with TRMA had diabetes mellitus, which is the most common clinical manifestation of TRMA. Thiamine supplementation can improve the symptoms of diabetes mellitus in children with TRMA [24]. In a follow-up study of 3 children with TRMA, Potter et al. [25] found that thiamine could delay the onset of diabetes mellitus, and that increasing the dosage of thiamine could reduce the severity of the disease and the need for insulin therapy in children with TRMA. TRMA lacks specific clinical manifestations, which has resulted in some patients not being diagnosed and treated in a timely manner, with serious consequences. For example, Kutlucan et al. [26] reported a case of a 32-year-old female patient diagnosed with myelodysplastic syndrome, whose anaemia could not be corrected by myelodysplastic syndrome treatment. The patient was subsequently diagnosed with TRMA by genetic testing and was then treated with intramuscular thiamine treatment for 4 months. The patient’s anaemia symptoms were improved after treatment. Therefore, a systematic study focusing on the pathogenic mechanism of TRMA will provide an important basis for improving the diagnostic efficiency and therapeutic efficacy in patients with TRMA.
The sole causative gene for TRMA is SLC19A2, which is located on human chromosome 1q24.2 [5, 27], contains 6 exons and encodes THTR-1 containing 497 amino acid residues spanning 12 putative transmembrane domains [2, 28]. To date, 74 mutations in the SLC19A2 gene have been identified in TRMA patients. These mutations are distributed over the entire coding region of the SLC19A2 gene, and their mutation forms include insertion mutations, deletion mutations, nonsense mutations, and missense mutations [23]. Mutations in SLC19A2 may alter the localisation of THTR-1 within the cell and cause THTR-1 dysfunction. Baron et al[29]. reported a case of TRMA patient with G172D mutation in the SLC19A2 gene, and constructed cell lines stably overexpressing wild-type SLC19A2 and SLC19A2 (G172D) mutant using NIH3T3 and Swiss 3T3 cells, respectively. Immunofluorescent staining of the cells indicated that wild-type SLC19A2 was mainly expressed in the cell membrane and cytoplasm, while the SLC19A2(G172D) mutant was mainly expressed in the ER and cytoplasm but less in the cell membrane, and the SLC19A2(G172D) mutation led to the misfolding of THTR-1, resulting in protein aggregation. Our previous study results were similar to the above. We found that THTR-1 in the wild-type SLC19A2 group was mainly expressed in the cell membrane, while THTR-1 in the SLC19A2 (c.1409insT) mutant group was mostly expressed in the nucleus and cytoplasm, and only a small amount was expressed in the cell membrane, producing protein aggregation. These findings indicate that the c.1409insT mutation in the SLC19A2 gene may lead to the aggregation of the misfolded protein THTR-1, triggering ERS.
ERS activates the unfolded protein response, the major ERS response. And the three pathways of ERS are PERK, IRE1 and ATF6 [23]. When ERS occurs in cells, it can transmit information through the transmembrane proteins PERK, IRE1, and ATF6 to promote the correct folding of unfolded or misfolded proteins, thus maintaining the internal homeostasis of the ER [30]. Therefore, ERS initially has a protective role. However, when perturbations to the internal environment of the ER are severe or persistent enough to remove unfolded or misfolded proteins, the cells initiate ERS-dependent death signalling pathways, mainly the PERK-eIF2α-Chop, IRE1-JNK-Bcl-2, and Caspase-12 pathways, thereby inducing apoptosis[31]. ERS first activates the PERK pathway, a type I ER transmembrane protein with serine/threonine protein kinase activity. Persistent ERS results in the dissociation of GRP78 to PERK and activation of PERK phosphorylation, which in turn phosphorylates eukaryotic initiation factor 2α (eIF2α) and prevents protein synthesis. PERK-eIF2α further induces the activation of ATF4, which up-regulates CHOP and Bcl-2 family members when irreversible damage occurs, thereby inducing apoptosis [12]. In this study, mutations in the SLC19A2 (c.1409insT) resulted in up-regulation of gene and protein expression levels of ATF4 and CHOP in INS.1 cells, and sustained ERS promoted apoptosis and inhibited cellular proliferation in pancreatic islet β-cells.
The occurrence and development of diabetes mellitus is closely related to the occurrence of ERS in pancreatic β-cells [6, 7, 32, 33]. Pancreatic islet β-cells have the highly developed ER that synthesises and secretes insulin, which is sensitive to ERS. ERS is triggered when unfolded or misfolded proteins accumulate in the cells. Persistent or intense ERS triggers apoptosis of pancreatic β-cells, leading to insufficient insulin secretion and diabetes mellitus [10]. For example, Lenin et al. [34] found that the expression of PERK, GRP78, and CHOP, was significantly higher in PBMCs from patients with type 2 diabetic than in the normal glucose tolerance group. Li et al. [35] reported that the expression of ERS-related signalling molecules, PERK and eIF2α, was significantly higher in the liver of type 2 diabetic rats than in normal rats. Yang et al. [36] found that high glucose could induce apoptosis in INS.1 cells and upregulate the expression of ERS-related signalling molecules ATF6, Xbp1, eIF2α, GRP78, and CHOP, suggesting that ERS may induce apoptosis of pancreatic islet β-cells, and is thereby involved in the pathogenesis of diabetes mellitus. Our results were similar to the above findings. In the present study, SLC19A2 (c.1409insT) mutation promoted apoptosis and inhibited cell proliferation in INS.1 cells and upregulated the gene and protein expression levels of ERS-PERK-related signalling molecules GRP78, PERK, CHOP, and ATF4, which may be involved in the pathogenesis of TRMA-mediated diabetes mellitus.
The development of diabetes mellitus is associated with islet β-cell damage, and the development of drugs that protect islet β-cells is crucial for the prevention and treatment of diabetes mellitus [33].
4-PBA has been used in the treatment of sickle cell disease, urea cycle disorders, thalassaemia, and cystic fibrosis diseases [37]. More studies are still needed regarding the therapeutic efficacy of 4-PBA in diabetes mellitus. 4-PBA is a chemically synthesised small molecule chaperone that improves ER folding capacity, stabilises protein conformation, and facilitates the transport of mutant proteins, thereby ensuring the homeostasis within the ER [38]. Several studies have found that 4-PBA has the ability to counteract ERS-induced apoptosis [16]. For example, it has been proven by Reddy et al. [39] that 4-PBA can inhibit the expression of ERS-related signalling factors GRP78, CHOP, and ATF4 in diabetic rats, thereby preventing muscle atrophy, protecting pancreatic beta cell function, and lowering blood sugar levels. It was discovered by Abdel-Ghaffar et al. [37] that 4-PBA can lower blood glucose levels, mitigate diabetic retinopathy, and diminish the expression of ERS-related molecules GRP78, CHOP, and p-elf2a in the retina of type 2 diabetic rats induced by streptozotocin. It was discovered that 4-PBA suppresses the expression of caspase-3, Bax, and ERS-related molecules Bip and CHOP in the pancreatic tissue of diabetic rats, while promoting the expression of Bcl-2, ultimately reducing pancreatic β-cell apoptosis [40]. In this study, we observed that 4-PBA can inhibit ERS triggered by the SLC19A2 (c.1409insT) mutation and downregulate the expression of ERS-related molecules GRP78, CHOP, and p-eIF2α. The mechanism behind 4-PBA’s protective effect on pancreatic β-cells may lie in its ability to inhibit ERS, offering novel insights and potential targets for the prevention and treatment of TRMA.
Conclusion
In summary, THTR-1 deficiency can lead to ERS and apoptosis, potentially contributing to the pathogenesis of TRMA-related diabetes. 4-PBA may protect pancreatic beta cells by inhibiting ERS, making it a promising new therapeutic target for both TRMA and diabetes.
Acknowledgments
This study was supported by the National Natural Science Foundation of China (82060170) and Guangxi Natural Science Foundation (2020GXNSFAA297264). The authors declare no competing financial interests. We also express our thanks to the Endokrynologia Polska’s editors, readers, and supporters.
Authors’ contribution
Yumei Qin reviewed the literature and conceived the study, making substantial contributions to conception and design, acquisition of data, and analysis and interpretation of data; Yumei Qin wrote the first draft of the manuscript; Xuan Zhang, Yuping Ye, Min Chen, Yuanyuan Qin, and Faquan Lin were involved in revising the article critically for important intellectual content. All authors reviewed and edited the manuscript and approved the final version to be published.
Conflicts of interest
The authors report no conflicts of interest in this work.
Funding
This study was supported by the National Natural Science Foundation of China (82060170) and Guangxi Natural Science Foundation (2020GXNSFAA297264).
