INTRODUCTION
Myocardial ischaemia/reperfusion injury (MIRI) after restoration of blood flow to the ischaemic heart can cause irreversible myocardial damage [7]. MIRI remains a severe threat to human beings, and the mortality rate of patients with MIRI is as high as 7% [29]. The occurrence and development of MIRI is a complex process modulated by complicated mechanisms [19]. Therefore, it is of great significance to explore the mediators and molecular mechanisms underlying MIRI.
Adipocyte enhancer binding protein 1 (AEBP1) was originally identified as a transcriptional repressor of the adipose P2 gene in adipocytes [15]. High expression of AEBP1 in macrophages has been reported to trigger the release of various pro-inflammatory cytokines, such as interleukin 6 (IL-6) and tumour necrosis factor alpha (TNF-α) [10]. Furthermore, functioned as a transcriptional suppressor, AEBP1 is implicated in the modulation of multiple pathophysiological processes, such as tumourigenesis and inflammation [8, 14]. A recent study found that AEBP1 was up-regulated in ischaemic cardiomyopathy patients [16]. Also, AEBP1 was demonstrated as a key promoter of cardiac fibrosis in heart failure [13]. However, the biological function of AEBP1 in MIRI and its detailed mechanisms remain obscure, which deserves to be investigated.
Nuclear factor kappa B (NF-κB) is a transcription factor that induces inflammatory response in a variety of cells. Accumulated studies have suggested that activation of NF-κB resulted in severe inflammatory injury in myocardial tissue during MIRI [25, 28]. Inactivation of NF-κB can effectively repress inflammation, thereby providing cardiac protection [27]. Inhibitor of κB alpha (IκBα) can bind to cytoplastic NF-κB p65/p50 heterodimer under normal conditions, which is considered as an inhibitor of NF-κB. Upon stimulation, IκBα is degraded via proteasomal pathway and consequently leads to NF-κB p65 nuclear translocation and activation [27]. Interestingly, previous studies have reported that AEBP1 could interact with IκBα to repress IκBα expression [2, 11]. Therefore, we predicted that AEBP1 might exacerbate MIRI via target repression of IκBα expression to trigger NF-κB-induced inflammation.
In this study, we aimed to investigate the role of AEBP1/IκBα axis in MIRI development in the in vitro and in vivo experimental models. Our findings provide new insights into the function of AEBP1 in MIRI.
MATERIALS AND METHODS
Cell culture and treatment
H9c2 cells were provided by American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in Dulbecco’s modified Eagle medium (DMEM) containing 10% foetal bovine serum at 37°C with 5% CO2. Oxygen-glucose deprivation/reoxygenation (OGD/R) was performed on H9c2 cells to simulate MIRI in vitro as described before [3]. In brief, H9c2 cells were cultured in DMEM without serum and glucose under hypoxia conditions (95% N2, 5% CO2) for 2, 4, 8, and 12 h. Subsequently, H9c2 cells were maintained in DMEM complete medium under normoxic condition for 24 h.
Cell transfection
siRNA targeting AEBP1 (siAEBP1), siIκBα, negative control siRNA (siNC), overexpression plasmid for AEBP1 (OE-AEBP1), and OE-vector were purchased from GeneChem (Shanghai, China). These segments were transfected into H9c2 cells using Lipofectamine 2000 (Thermo Fisher, Waltham, MA, USA).
Cell counting kit-8 (CCK-8)
H9c2 cells were planted into 96-well plates (1 × 104 cells per well). After various treatments, H9c2 cell viability was measured using the Enhanced Cell Counting Kit 8 (Elabscience, Wuhan, China), as previously described [23]. Briefly, the cells were added with 10 μL of CCK-8 solution, followed by incubation at 37°C for 3 h. The results were obtained at 450 nm using a microplate reader (Molecular Devices, San Jose, CA, USA).
TUNEL
Apoptosis was evaluated using the One-step TUNEL In Situ Apoptosis Kit (Green, Elab Fluor 488) and One-step TUNEL In Situ Apoptosis Kit (Red, Elab Fluor 594) (Elabscience). For myocardial tissues, the paraffin sections were subjected to dewaxing, rehydration, proteinase K, and 3% hydrogen peroxide treatment. The sections were reacted with the TUNEL reaction mixture. For H9c2 cells, the cell monolayers were mounted on coverslips, followed by proteinase K treatment and incubation with the TUNEL reaction mixture. After nuclear staining with DAPI, the labelled apoptotic cells were observed with a fluorescence microscope (Olympus, Tokyo, Japan).
Enzyme-linked immunosorbent assay (ELISA)
The levels of LDH, CK-MB, TNF-α, IL-1β, and IL-6 in the cellular supernatant or serum samples were evaluated using the commercial ELISA kits for lactate dehydrogenase (LDH, SEB864Ra), creatine kinase MB isoenzyme (CK-MB, SEA479Ra), tumour necrosis factor alpha (TNFa, SEA133Ra), interleukin 1 beta (IL1b, SEA563Ra), and interleukin 6 (IL6, SEA079Ra), following the instructions.
Quantitative reverse transcription PCR (RT-qPCR)
RT-qPCR was performed as described before [26]. In brief, total RNA was extracted from H9c2 cells using the TRIzol reagent (Thermo Fisher), and subsequently transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Thermo Fisher). qPCR was conducted using the SYBR Green PCR Kit (QIAGEN, Germany), with GAPDH used as an internal reference control. The PCR primer sequences are shown in Table 1. The relative expression of genes was analysed using the 2−ΔΔCt method.
|
Name |
Sequence (5’¬3’) |
Length |
|
AEBP1 F |
CATCCGCATCTATCCACTAC |
20 |
|
AEBP1 R |
ACCTCATCCTCGTCTTCTCC |
20 |
|
IκBα F |
CGTGTCTGCACCTAGCCTCTATC |
23 |
|
IκBα R |
GCGAAACCAGGTCAGGATTC |
20 |
|
GAPDH F |
GACATGCCGCCTGGAGAAAC |
20 |
|
GAPDH R |
AGCCCAGGATGCCCTTTAGT |
20 |
Western blotting
Western blotting was conducted according to a previous study [21]. Briefly, cells were lysed in the RIPA Lysis Buffer (Absin, Shanghai, China). Total protein in the supernatant was collected after centrifugation and quantified using the BCA assay kit (Absin). Then, the protein samples were subjected to SDS-PAGE and blotted onto polyvinylidene fluoride membranes. After blocking in defatted milk, the membranes were incubated with primary antibodies, including AEBP1 (A16340, 1:1000, ABclonal, Wuhan, China), IκBα (A11397, 1:500, ABclonal), NF-κB p65 (A2547, 1:500, ABclonal), β-actin (AC006, 1:500, ABclonal), and histone H3 (A2348, 1:2000, ABclonal) at 4°C overnight, followed by probing with secondary antibody for 1 h. The protein blots were detected using the ECL kit (Absin).
Co-immunoprecipitation (Co-IP)
Co-IP was performed as described previously [12]. Briefly, whole cell lysates were prepared using the RIPA Lysis Buffer, followed by centrifugation at 10,000 g for 10 min at 4°C. Thereafter, the cell lysates were immuno-precipitated with anti-IκBα (A11397, 1:20, ABclonal), or anti-IgG antibody (1:100, Cell Signalling Technology, Danvers, MA, USA) for 16 h, and then incubated with protein A/G agarose beads (Thermo Fisher) overnight at 4°C. Then, the immunocomplexes were spun down, recovered, and boiled for 10 min at 100°C. The protein levels of AEBP1 and IκBα were assessed by Western blotting.
Animal model
All animal experiments were carried out in accordance with the NIH guidelines and approved by the Institutional Animal Care and Use Committee of Zhangjiakou First Hospital. Male Sprague Dawley rats (200–250 g) were provided by Charles River Laboratories (Beijing, China) and randomly assigned to Sham, MIRI, MIRI + siNC, MIRI + siAEBP1, or MIRI + siAEBP1 + siIκBα groups (n = 6 per group). MIRI was induced by left anterior descending artery (LAD) ligation. Briefly, the rats were anaesthetised with pentobarbital (30 mg/kg, intraperitoneally) and then received left thoracotomy. The LAD was ligated using a 6–0 silk suture for 30 min. Subsequently, the ligature wire was loosened to achieve myocardial reperfusion. Sham rats received the same surgery without LAD ligation. For in vivo transfection, siAEBP1, siIκBα, or siNC (50 μg) dissolved in the in vivo-jetPEI reagent (Polyplus-transfection, USA) were injected into the left ventricle anterior wall of rats 48 h before MIRI induction [17]. All rats were euthanised by an overdose of pentobarbital (120 mg/kg, intravenously). The serum and heart samples were collected for further analysis.
Cardiac function
Cardiac function of rats was evaluated by echocardiography using Vevo 2100 (VisualSonics, Toronto, Canada). Left ventricular ejection fraction (LVEF) and left ventricular fraction shortening (LVFS) were detected from at least 3 consecutive cardiac cycles.
2,3,5-triphenyltetrazolium chloride (TTC) staining
After washing by saline, 0.3% Evans Blue staining solution was injected into the aorta. The hearts were cut into 1.5-mm sections, followed by staining with 1% TTC at 37°C for 20 min. The infarct area was analysed using a light microscope (Olympus) and quantified by Image-Pro Plus 5.0 software.
Haematoxylin and eosin (H&E) staining
The heart tissues were fixed with 10% formaldehyde solution, embedded in paraffin, and sliced into 5 µm sections. The prepared sections were stained using the H&E staining kit (Sangon, Shanghai, China). Images were photographed under a light microscope.
Statistical analysis
Data are presented as mean ± standard deviation (SD). GraphPad Prism 6.0 was adopted for statistical analysis using Student’s t test for 2-group or One-Way ANOVA for multiple-group comparison. A p-value less than 0.05 was considered as statistically significant.
RESULTS
Up-regulation of AEBP1 and down-regulation of IκBα in OGD/R-exposed cardiomyocytes
First, H9c2 cardiomyocytes were stimulated with OGD/R to simulate HIRI in vitro. H9c2 cell viability was strikingly declined with prolonged OGD time (Fig. 1A). Meanwhile, the apoptotic percentage of H9c2 cells elevated from OGD 2 h to 12 h after reperfusion (Fig. 1B). Moreover, the release of TNF-α, IL-1β, and IL-6 from H9c2 cells was time dependently enhanced after OGD/R stimulation (Fig. 1C). Notably, the mRNA and protein levels of AEBP1 were enhanced, while IκBα levels were reduced in OGD/R-exposed H9c2 cells in a time-dependent manner (Fig. 1D). Thus, AEBP1 expression was increased, but IκBα expression was decreased during OGD/R-induced cardiomyocyte injury.
AEBP1 modulated OGD/R-induced inflammation and apoptosis in cardiomyocytes
Given that AEBP1 was dysregulated by OGD/R stimulation, we further evaluated its influence on OGD/R-induced cardiomyocyte damage. For this purpose, H9c2 cells were transfected with siAEBP1 or OE-AEBP1, and then subjected to OGD/R. We found that the enhanced expression of AEBP1 in OGD/R-stimulated H9c2 cells was abolished by siAEBP1 transfection but intensified by OE-AEBP1 transfection (Fig. 2A, B). Functionally, knockdown of AEBP1 restored the decreased viability of OGD/R-challenged H9c2 cells, whereas AEBP1 overexpression led to the opposite result (Fig. 2C). In addition, apoptosis of H9c2 cells was restrained by AEBP1 silencing but promoted by AEBP1 overexpression in response to OGD/R (Fig. 2D). Furthermore, OGD/R-induced TNF-α, IL-1β, and IL-6 production was attenuated by AEBP1 deficiency but strengthened by AEBP1 overexpression (Fig. 2E). These observations suggested that high expression of AEBP1 contributed to OGD/R-induced inflammation and apoptosis in H9c2 cells.
AEBP1 repressed IκBα expression to trigger NF-κB activation
To further investigate the downstream regulatory mechanism of AEBP1 in OGD/R-induced cardiomyocyte injury, IκBα was focused on. Co-IP assay demonstrated that AEBP1 directly interacted with IκBα protein, which was enhanced by OGD/R challenge (Fig. 3A). Additionally, the elevated expression of nuclear NF-κB p65 and declined expression of IκBα were reversed in AEBP1-depleted H9c2 cells upon OGD/R stimulation. Conversely, AEBP1 overexpression further up-regulated nuclear NF-κB p65 but down-regulated IκBα (Fig. 3B). Therefore, AEBP1 directly interplayed with IκBα to inhibit its expression, thereby activating NF-κB pathway.
AEBP1 knockdown restrained OGD/R-induced inflammation and apoptosis via IκBα inhibition
Next, we verified whether the AEBP1/IκBα axis modulated OGD/R-induced inflammation and apoptosis in H9c2 cells. To achieve this, H9c2 cells were transfected with siAEBP1 with or without siIκBα. As shown in Fig. 4A, siAEBP1-mediated up-regulation of IκBα in OGD/R-exposed H9c2 cells was counteracted by IκBα knockdown. Moreover, inhibition of AEBP1-induced elevation in OGD/R-treated H9c2 cell viability was abrogated by IκBα silencing (Fig. 4B). Also, the anti-apoptotic role of siAEBP1 in H9c2 cells upon OGD/R stimulation was abolished by IκBα depletion (Fig. 4C). Additionally, co-transfection with siIκBα reversed AEBP1 deficiency-induced down-regulation of TNF-α, IL-1β, and IL-6 levels in the supernatant of OGD/R-challenged H9c2 cells (Fig. 4D). Taken together, AEBP1 depletion attenuated OGD/R-induced inflammation and apoptosis via down-regulation of IκBα.
AEBP1 down-regulation ameliorated MIRI in rats via the IκBα/NF-κB pathway
Finally, we validated the role of the AEBP1/IκBα axis in MIRI rats in vivo. The infarct volume of hearts from MIRI rats was remarkably increased, which could be reduced by AEBP1 knockdown. However, IκBα silencing counteracted the siAEBP1-induced decrease in infarct volume (Fig. 5A). HE staining indicated that MIRI triggered pathological alterations in the heart tissues, including inflammatory infiltration, necrosis, and structural abnormality. AEBP1 depletion attenuated these pathological damages, which was abolished by IκBα deficiency (Fig. 5B). In addition, the elevated levels of myocardial enzymes LDH and CK-MB indicated myocardial injury of MIRI rats. AEBP1 down-regulation effectively reduced serum LDH and CK-MB levels of MIRI rats, whereas co-inhibition of IκBα significantly raised LDH and CK-MB levels (Fig. 5C, D). In addition, cardiac function was improved in AEBP1-silenced rats via enhancement of LVEF and LVFS levels, which was counteracted after IκBα depletion (Fig. 5E). Moreover, the apoptosis in myocardial tissues of MIRI rats was weakened by AEBP1 deficiency, whereas IκBα silencing reversed the anti-apoptotic effect of siAEBP1 (Fig. 5F). Also, the enhanced serum TNF-α, IL-1β, and IL-6 levels of MIRI rats were down-regulated by AEBP1 knockdown; however, these pro-inflammatory cytokine levels were elevated by co-silencing of IκBα (Fig. 5G). Western blotting revealed that up-regulation of AEBP1 and nuclear NF-κB p65, and down-regulation of IκBα in heart tissues of MIRI rats were reversed in AEBP1-depleted rats, which were abrogated when IκBα was knocked down (Fig. 5H). The above results suggest that AEBP1 depletion attenuated MIRI in rats via promotion of IκBα-mediated inactivation of NF-κB.
DISCUSSION
MIRI has been recognised as a dangerous pathological process after reperfusion therapy in myocardial infarction patients [24]. Identification of the mechanisms and protective measures of MIRI has become a hotspot in this field of medicine. In this study, we found that AEBP1 was highly expressed during OGD/R-induced cardiomyocyte inflammation and apoptosis. Subsequently, we verified that AEBP1 silencing blocked OGD/R-induced cardiomyocyte injury, while AEBP1 overexpression exacerbated OGD/R-triggered cardiomyocyte damage. In addition, AEBP1 knockdown promoted IκBα expression to inactivate NF-κB pathway in OGD/R-stimulated H9c2 cells, and depletion of IκBα reversed AEBP1 deficiency-induced cardioprotective effects in vitro and in vivo. Therefore, our findings demonstrated that AEBP1 inhibition ameliorated MIRI via increased IκBα expression.
MIRI can be caused by inflammation via complicated molecular mechanisms [22]. It has been proven that inflammation is a distinct feature of MIRI, which drives cardiomyocyte apoptosis and injury [1, 18]. Mounting evidence has identified that a great deal of immune cells are infiltrated in myocardial tissue during MIRI, and they produce large amounts of pro-inflammatory cytokines, including TNF-α, IL-1β, and IL-6 [18]. Myocardial inflammation after MIRI exerts a crucial role in aggravating cardiac dysfunction and results in a bad prognosis of myocardial infarction patients. Thus, anti-inflammatory therapy represents a key strategy to attenuate MIRI [20]. AEBP1 is a transcriptional regulator that is implicated in the modulation of various biological processes including inflammation [9]. For example, AEBP1 facilitated macrophage inflammatory responsiveness via increasing NF-κB activity during mammary epithelial cell hyperplasia [6]. Ren et al. documented that AEBP1 acted as a driver of inflammation, which contributed to the pathological development of abdominal aortic aneurysm [14]. In line with these studies, we discovered that down-regulation of AEBP1 restrained myocardial inflammation and apoptosis in MIRI models. Overall, our results demonstrated, for the first time, AEBP1 as a potential treatment target for MIRI.
Next, we focused on the detailed molecular mechanism through which AEBP1 enhanced myocardial inflammatory response in MIRI. A previous study showed that AEBP1 played its proinflammatory role via enhancement of NF-κB activity through hampering of IκBα [11]. Here, we found a negative relationship between AEBP1 expression and IκBα expression in OGD/R-exposed cardiomyocytes. IκBα protein inhibits NF-κB nuclear translocation via its capacity to bind to NF-κB subunits, which remains NF-κB in an inactive state in cytoplasm [4]. Upon stimulation, IκBα protein is degraded and separates from NF-κB subunits, thereby leading to nuclear translocation of NF-κB and subsequent transcriptional activation of proinflammatory genes [5]. Similarly, our results suggested that AEBP1 physically interplayed with IκBα via a protein-protein interaction. Interestingly, our findings suggest that AEBP1 loss led to a remarkable increase in IκBα level and reduction in nuclear NF-κB level in cardiomyocytes upon OGD/R stimulation. Remarkably, IκBα knockdown diminished the protection against MIRI caused by AEBP1 deficiency. Collectively, AEBP1-IκBα interaction was crucial for inflammation and apoptosis during MIRI-induced myocardial damage.
Taken together, our observations revealed that AEBP1 promoted the release of pro-inflammatory cytokines and apoptosis induced by MIRI through hampering of IκBα inhibitory function to facilitate NF-κB nuclear translocation. These findings suggest that AEBP1 inhibition possesses cardioprotective effects and may identify as an intervention for MIRI.
ARTICLE INFORMATION AND DECLARATIONS
Data availability statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Ethics statement
All animal experiments were carried out in accordance with the NIH guidelines and approved by the Institutional Animal Care and Use Committee of Zhangjiakou First Hospital.
Author contributions
Wei-Na Xue is responsible for the study design, experimental conduct, data analysis, and paper writing.
Funding
None.
Conflict of interest
The author declares that he has no competing interests to disclose.
